Skip to content Skip to sidebar Skip to footer

what cells have glycine receptors to inhibit muscle contraction

  • Journal List
  • FASEB J
  • PMC4048936

FASEB J. 2011 May; 25(five): 1706–1717.

Novel expression of a functional glycine receptor chloride channel that attenuates wrinkle in airway shine muscle

Received 2010 Aug 27; Accustomed 2011 Jan thirteen.

Supplementary Materials

Supplemental Data

GUID: D907F255-54BE-4CE7-97E8-7CA7FEF7D127

GUID: BFBA9FAD-FBD1-4F96-9D7C-DC383AC5F4F4

Abstract

Airway smooth muscle (ASM) contraction is an important component of the pathophysiology of asthma. Taurine, an agonist of glycine receptor chloride (GlyR Cl−) channels, was establish to relax contracted ASM, which led us to question whether functional GlyR Cl− channels are expressed in ASM. Messenger RNA for β (GLRB), α1 (GLRA1), α2 (GLRA2), and α4 (GLRA4) subunits were constitute in human being (Homo sapiens) and guinea squealer (Cavia porcellus) tracheal smooth muscle. Immunoblotting confirmed the protein expression of GLRA1 and GLRB subunits in ASM. Electric activity of cultured human ASM cells was assessed using a fluorescent potentiometric dye and electrophysiological recordings. Glycine increased current and significantly increased fluorescence in a dose-dependent manner. The GlyR Cl− channel antagonist strychnine significantly blocked the furnishings of glycine on potentiometric fluorescence in ASM cells. Guinea sus scrofa airway band relaxation of ACh-induced contractions past isoproterenol was significantly left-shifted in the presence of glycine. This event of glycine was blocked by pretreatment with the GlyR Cl− channel antagonist strychnine. Glycine treatment during tachykinin- and acetylcholine-induced contractions significantly decreased the maintenance of muscle force compared to control. GlyR Cl− channels are expressed on ASM and regulate smooth muscle force and offer a novel target for therapeutic relaxation of ASM.—Yim, P. D., Gallos, G., Xu, D., Zhang, Y., Emala, C. W. Novel expression of a functional glycine receptor chloride channel that attenuates wrinkle in airway smooth musculus.

Keywords: membrane potential, isoproterenol, organ bathroom, guinea pig, FLIPR

The worldwide incidence of asthma continues to increase, yet the pharmacological approaches to airway shine musculus relaxation have not improved since the introduction of β-adrenoreceptor agonists many decades ago. Not merely are some patients with asthma refractory to β-adrenoreceptor therapy, simply significant morbidity and mortality have been associated with the use of long-interim β-adrenoreceptor agonists (1). Thus, the need for alternative approaches to relax airway smooth muscle in asthma is urgent.

Intracellular calcium levels are a key regulator of the contractile tone of airway polish muscle. The plasma membrane electric potential influences the calcium sensitivity of contractile proteins and the handling of calcium from both extracellular sources and intracellular stores (2, 3). Thus, the manipulation of plasma membrane potential via ligand-gated ion channels is an bonny therapeutic target for modulation of airway smooth musculus tone. Our laboratory has recently shown that one family unit of ligand-gated ion channels, the classic neuronal GABAA chloride inhibitory channel, is expressed and is functionally coupled to the relaxation of airway smooth muscle (4). During these studies, information technology was discovered that taurine, an agonist at both the GABAA channel and GlyR Cl− aqueduct, potentiated isoproterenol-mediated relaxation of airway smooth muscle, simply this prorelaxation effect was only partially attenuated past the GABAA aqueduct antagonist, gabazine. Therefore, we questioned whether taurine'south prorelaxant effects might also be modulated through GlyR Cl− channels, which have never earlier been described on airway shine muscle.

GlyR Cl− channels are inhibitory chloride channels abundantly expressed in the spinal cord and belong to the aforementioned pentameric ligand-gated channel family as GABAA (5). GlyR Cl− channel pentamers are made upwardly of 5 known subunits (GLRA1, GLRA2, GLRA3, GLRA4, and GLRB) in either homomeric or heteromeric form. Naturally occurring homomers are made of v GLRA2 subunits, and heteromers comprise a combination of GLRA and GLRB subunits (vi). Subunit combinational specificity dictates the pharmacokinetic, pharmacodynamic, and binding affinity profiles of individual GlyR Cl− channels, but all GlyR Cl− channels acquit chloride ions, which, in neuronal cells, favor plasma membrane hyperpolarization (v). Interestingly, β-adrenoreceptor-mediated relaxation of airway smooth musculus is due, in part, to plasma membrane hyperpolarization via opening of plasma membrane big-conductance, calcium-activated potassium channels (KCa; ref. 7). GABAA and glycine chloride channels are similar in structure and office, leading us to question whether GlyR Cl− channels are expressed on airway smoothen muscle and whether activation of these GlyR Cl− channels would mimic the prorelaxant effects of GABAA channel activation, identifying a novel therapeutic target for relaxation of airway smooth musculus.

MATERIALS AND METHODS

Materials

Glycine, indomethacin, capsaicin, pyrilamine, and acetylcholine were obtained from Sigma (St. Louis, MO, USA). The fluorescent potentiometric probe (FLIPR) membrane potential assay kit was obtained from Molecular Devices (Sunnyvale, CA, USA). The protease inhibitor cocktail ready III was purchased from Calbiochem (Gibbstown, NJ, USA). Trypsin 0.05%- EDTA was purchased from Invitrogen (Carlsbad, CA, USA). TRIzol reagent was obtained from Ambion (Austin, TX, United states). Antibodies for the GLRA1 subunit of the GlyR Cl− aqueduct were obtained from Millipore (Billerica, MA, USA). Antibodies for the GLRB subunit of the GlyR Cl− aqueduct were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, Usa).

Prison cell civilisation

Cultures of immortalized human airway polish muscle cells were a kind souvenir from Dr. William Gerthoffer (Academy of South Alabama, Mobile, AL, USA) and have previously been characterized (8). The cells were grown to confluence in 75-cm2 flasks for RT-PCR and immunoblot assays, and 96-well blackness-walled clear bottom plates for fluorescent FLIPR membrane potential assays. All cells were maintained in SmBM2 medium (Lonza, Walkersville, Dr., USA) at 37°C in 95% air/5% CO2 equally described previously (4).

Isolation of smoothen muscle from man trachea and guinea pig

All homo airway tissue protocols were reviewed by the Columbia University Institutional Review Board and were accounted not human subjects research under 45 CFR 46. Human tracheal tissue was obtained from the National Disease Inquiry Interchange (NDRI; Philadelphia, PA, USA) or from discarded airway tissue from healthy lung donors during transplantation surgery at Columbia Academy.

All guinea hog protocols were approved by the Columbia University Institutional Animate being Care and Use Committee. Guinea pigs were deeply anesthetized with 50 mg/kg pentobarbital. The breast cavity was opened, and the guinea pigs were exsanguinated. Whole brain (positive controls for RT-PCR and immunoblot), retina (positive control for immunoblot), and the unabridged trachea were excised and immersed in common cold Kreb-Henseleit (KH) buffer (in mM: 118 NaCl, five.6 KCl, 0.5 CaClii, 0.236 MgSO4, 1.3 NaH2POiv, and 5.6 glucose, pH seven.4).

For both human and guinea pig airways, fibrous tissue from the extraluminal side of the trachea was carefully dissected and discarded. The tracheal epithelial layer was removed either by gentle intraluminal abrasion for the republic of guinea sus scrofa or by fine dissection of airway epithelium with forceps in the human. The intact trachea was then either divided into rings for musculus force studies performed in organ baths or frozen in optimal cutting temperature (October) compound (Sakura Finetek, Torrance, CA, U.s.) for laser microdissection-assisted RNA extraction or dissected under a dissecting microscope to remove smooth muscle for poly peptide extraction.

Isolation of RNA by laser capture microdissection (LCMD) and opposite transcription of cDNA

Freshly dissected and excised homo and guinea pig tracheal rings were embedded in October compound followed by isopentane/dry ice freezing. 6 sequent frozen sections (10 μm) were made under RNase-free weather and were placed on a single i-mm PEN-membrane-coated slide (PALM Microlaser Technologies, Westchester, NY, USA) and processed for RNA preservation and cell staining using a LCMD staining kit (Ambion AM1935). Histological confirmation of stained sections guided subsequent laser dissection, harvesting only central portions of smoothen muscle to avoid contamination from bordering cells using a PALM MicroBeam light amplification by stimulated emission of radiation microscope. RNA was recovered from LCMD samples using a RNAqueous-micro kit (Ambion) according to manufacturer'south recommendations. Recovered RNA was reversed transcribed into cDNA using i of two commercial kits, Advantage RT-for-PCR (BD Biosciences, Mount View, CA, Us) or SuperScript III (Invitrogen). LCMD-captured RNA (10 μl) in sample buffer was reverse transcribed using random hexamer primers at 42°C for 1 h in xx μl, according to manufacturers' recommendations. Because the content of RNA in LCMD samples is very small, quantification of RNA was not performed.

Isolation of RNA from cultured airway smooth muscle and opposite transcription of cDNA

RNA was extracted from immortalized cultured human airway smooth muscle cells using the TRIzol reagent (Ambion), according to the manufacturer's recommendations. Using 2 RT-PCR kits, Advantage RT-for-PCR (BD Biosciences) and Super Script III (Invitrogen), 1 μg RNA from each sample was opposite transcribed using random hexamer primers at 42°C for 1 h in 20 μl according to manufacturers' recommendations.

PCR

Newly synthesized cDNA (5 μl) from RNA isolated by LCMD from native guinea pig or man airway shine muscle and cultured immortalized human airway polish musculus cells were used in PCR using the Advantage Polymerase Kit (Clontech, Mountain View, CA, U.s.). Sense and antisense primers (0.4 μM) were used for corresponding GlyR Cl− channel subunits ( Table 1 ). All cDNA samples were denatured at 94°C for x s. Annealing temperatures were all 68°C for i min. Each sample underwent 45 cycles of distension in a PTC-200 Peltier thermal cycler (Bio-Rad, Hercules, CA, United states). PCR products were analyzed on a five% nondenaturing polyacrylamide gel in Tris acetate, EDTA buffer. The gel was stained with ethidium bromide (Molecular Probes, Eugene, OR, U.s.a.) and visualized using a gel imager (Biospectra UVP, Upland, CA, The states) and Visionworks software (Biospectra UVP). PCR products were sequenced to confirm identity (GeneWiz, S Plainfield, NJ, USA; Supplemental Table S1).

Table 1.

Primers used for PCR amplification of glycine receptor chloride channel subunits in guinea sus scrofa and human airway smooth musculus

Name Primer sequence, 5′–3′ Production size (bp)
GLRA1 GAGAAGGACTTGAGATACTGCACCATGTTGATCCAGAAGGAGATCCATGAG 163
GLA2 CCTCCGAAGAAGACAGAAGAGGCAGAATAGCCCGGTCCACAAACTTCTTCTTGATAG 195
Human GLRA3 GAATAAGACAGAAGCTTTTGCACTGGAGAAGTTGCTCGGGAGATGGTATCAATCTTCTTGG 237
Republic of guinea pig GLRA3 CTTTTGCACCAAGCACTACAACACAGGTCATGCCTAAGAATTTTATAGATAACCCAGTAGA 292
GLRA4 GAAGATGCTCCTGCTGTCCAAGTGCAGAAGGAGACCCAGGACAGGATGA 218
GLRB TGGAAAAGGTGGAAATGTGGCTAAAAAGAACAATGCTGAAGTCATTAGATCTCAGATCAGACTTAGAA 146

Immunoblot

Confluent cultures of human airway smooth muscle cells were rinsed in cold PBS and mechanically removed from the surface of the culture flask in the presence of protease inhibitor cocktail (Calbiochem protease inhibitor cocktail gear up Iii, EDTA free). Cells were centrifuged at 200 g for 10 min at 4°C, and the pellet was resuspended in RIPA buffer every bit described previously (4). Cell suspensions were homogenized at 4°C using a high-speed homogenizer at summit speed for 30 southward. Whole-prison cell lysates were solubilized by heating at 95°C for x min in gel loading buffer, as described previously (iv).

Native guinea hog and homo airway shine muscle were dissected with a microscope from trachea and mainstem bronchi and were homogenized at top speed for thirty s in RIPA buffer. Homogenized whole tissue lysate was then centrifuged at 500 g for 10 min at iv°C. Supernatant was stored at −lxxx°C. Each sample was then solubilized by heating in 95°C heating cake for 10 min in denaturing gel loading buffer (4).

All samples (60–90 μg) and positive controls (sixty–xc μg) were electrophoresed (viii% SDS-Page) and transferred to PVDF membranes. Nonfat milk (5%)was used to block nonspecific binding sites for one h. Primary antibodies were applied in one% nonfat milk overnight at 4°C (main antibodies and dilutions listed in Table ii ). HRP-labeled secondary antibody in 1% milk was then applied for 1 h at room temperature. Visualization was obtained by ECL (GE Healthcare, Niggling Chalfont, U.k.) or Super Signal Femto (Pierce, Rockford, IL, USA) and was recorded on movie (Kodak BioMax light film; Kodak, Rochester, NY, USA) or digital pictures (Biospectra UVP).

Table ii.

Principal antibodies used for immunoblot detection of glycine channel subunits

Primary antibody Product number Source Dilution MW (kDa)
GLRA1 Santa Cruz 17283 Rabbit 1:1000 65
GLRB Millipore Ab15012 Goat 1:k 48

Electrophysiology

Immortalized human being airway smooth muscle cells were grown to confluence on collagen-treated T25 flasks. Collagenase blazon IV in SmBM2 medium was used to release cells adherent to the collagen matrix in the flask. Medium with cells in pause was then harvested in a 10-ml conical tube and centrifuged at 300 chiliad. Supernatant was removed, and the pellet was resuspended in SmBM2 medium and transferred into collagen-treated glass lesser 1-cm Petri dishes at ∼ten% confluence. Each dish was then incubated at 37°C 5% CO2 for ane–iv h for reattachment of cells to glass-bottom Petri dishes.

Glass-bottom dishes served as a dispensable recording bedroom. ALA VM-eight, an 8-bedroom pressure-driven drug application organisation, was used in a yet bath of extracellular salt solution. Whole-prison cell intracellular voltage recordings under current clench conditions were performed with a 2-kHz Bessel filter, recording at x kHz using an Axopatch 200b amplifier (Axon Instruments, Foster Urban center, CA, USA). Intracellular solutions consisted of (in mM) 140 KCl, 5 MgATP, 5 EGTA, one MgCl2, 10 HEPES, and v CaCl2 (pH 7.ii). Extracellular solution consisted of (in mM) 134 NaCl, 1.4 KCl, 10 HEPES, 1 MgClii, 1.eight CaCl2, and 10 glucose (pH seven.4). Electrodes were pulled using a P-97 micropipette puller from i.five-mm OD borosilicate capillary glass (Sutter Instruments, Novato, CA, USA). Glass electrode resistances ranged from 5 to 10 MΩ with intracellular solution.

Whole-cell intracellular current recordings under voltage-clamp conditions were performed with a ii-kHz Bessel filter, recording at ten kHz using an Axopatch 200b amplifier. When recording glycine responses, the intracellular solutions consisted of (in mM) 130 CsCl, 5 MgATP, five EGTA, i MgCl2, 10 HEPES, and v CaCltwo (pH 7.2), and the extracellular solution consisted of (in mM) 130 CsCl, x HEPES, 1 MgCl2, ane.viii CaCl2, and 10 glucose (pH 7.4). When recording Chiliad-gluconate electric current responses, intracellular and extracellular solutions were the same as the solutions previously mentioned in the voltage recordings protocol. Electrodes were pulled using a P-97 micropipetter puller from 1.5-mm OD borosilicate capillary glass (Sutter Instruments). Glass electrode resistances ranged from 5 to 10 MΩ with intracellular solution. All recordings were analyzed on Clampfit eight.0 software (Molecular Devices).

Membrane potential measurements using FLIPR

The functional aqueduct activity of the GlyR Cl− channels was also characterized using the FLIPR membrane potential assay. Protocols have been described previously (ix). Man airway polish musculus cells were grown to 100% confluency in 96-well black-walled clear-bottom plates. Cells were treated with medium with serum 24 h prior to assay (SmGm2 medium). On the day of the analysis, cells were washed with Krebs buffer, equally described previously (9). FLIPR membrane potential blue dye was dissolved in Krebs buffer at the concentration of 1 vial (∼125 mg) in 100 ml. Cells were incubated in 100 μl of 50% dye for xx min in a humidified 37°C jail cell culture incubator (95% air/v% CO2). Fluorescence was repetitively measured at 2-s intervals in a prewarmed (37°C) Flex Station 3 UV spectrophotometer (Molecular Devices) using an excitation wavelength of 530 nm, an emission wavelength of 565 nm and a cutoff filter of 550 nm. NS1619 (100 μM; potassium channel opener causing hyperpolarization), 40 mM K-gluconate (depolarizing amanuensis) or ane mM glycine was added at a single concentration. In separate assays, glycine at increasing concentrations (ane μM–i mM) was automatically injected into individual wells with or without a 400 μM strychnine pretreatment.

Functional studies of airway smoothen muscle

Closed guinea pig tracheal rings containing ii incomplete cartilagenous rings were suspended at 1 g resting tension in oxygenated KH buffer at 37°C, as described previously (10, 11). Briefly, closed rings were tied with silk suture on the cartilage at the cartilage-shine muscle border bilaterally. One suture was tied to a fixed hook, while the other suture was tied to a Grass FT03 strength transducer (Grass Telefactor, West Warwick, RI, U.s.a.). The closed ring remained in a temperature-controlled bath filled with 4 ml KH buffer, and muscle force was continuously digitally recorded. Each tracheal ring was precontracted with a standardized pretreatment paradigm. Rings were first contracted with N-vannilylnonanamide (x μM), a capsaicin analog that depletes nonadrenergic noncholinergic nerves. KH buffer was exchanged in the organ baths, resting tone was reset to 1 g, and the tracheal rings were subjected to 2 cycles of increasing log concentrations of ACh (100 nM–100 μM). All baths were done by half-dozen KH buffer exchanges, and tensions were adjusted to i chiliad afterward each cycle. Post-obit the second cycle of an acetylcholine dose response, the organ bath KH buffer was exchanged 8 times, and resting tension was adjusted to 1 g. To eliminate the confounding effects of airway fretfulness and histamine receptors, tetrodotoxin (1 μM) and pyrilamine (x μM) were added to the buffers of all organ baths. Rings then underwent divide experiments in which they were contracted with acetylcholine (EC50 concentration) or 100 nM β-ala NKA fragment 4–10 (a subtype-selective agonist at the neurokinin type 2 receptor) in the absence or presence of glycine or taurine with or without pretreatment with GlyR Cl− aqueduct antagonists (strychnine and ginkoglide B), equally detailed beneath.

In vitro assessment of glycine effects on tension after an acetylcholine EC50 wrinkle

Post-obit the in a higher place standardized pretreatments, each guinea pig tracheal band was contracted with an ECfifty acetylcholine contraction. At peak tension, baths were randomly assigned as control (untreated) or treated (1 mM glycine) rings with measurement of the maintenance of muscle strength over 10 min.

In vitro assessment of glycine effects on tension after a β-ala-NKA fragment 4–10 contraction

Following the above standardized pretreatments, each republic of guinea pig tracheal ring was contracted with 100 nM β-ala-NKA fragment iv–10. At steady-state tension (∼5 min) baths were randomly assigned as control (untreated) or treated (1 mM glycine) rings with measurement of the maintenance of muscle forcefulness over xx min.

In vitro assessment of GlyR Cl− channel agonist effects on βtwo-adrenoreceptor-mediated airway smooth musculus relaxation after an ECfifty contraction with acetylcholine

Each guinea pig tracheal band was contracted by acetylcholine ECl dose determined by the in a higher place precontraction protocol. At steady state tension (∼15 min), each bathroom was randomly assigned into iii handling groups. Control groups were exposed to cumulatively increasing isoproterenol concentrations in half-log increments, equally described previously (10). Experimental groups were pretreated with 100 μM taurine or 1 mM glycine 5 due south before isoproterenol treatments. In split experiments, GlyR Cl− channels were pretreated with antagonists before the add-on of taurine/isoproterenol or glycine/isoproterenol. Taurine-treated groups were antagonized by pretreatment with 1 μM ginkoglide B and iii μM strychnine xv min before the acetylcholine contractile challenge. Glycine-treated groups were antagonized by pretreatment with 3 μM strychnine fifteen min earlier contractile the acetylcholine claiming.

Statistical assay

Each experimental permutation included intraexperimental vehicle controls. Nosotros employed i-mode ANOVA with Bonferroni mail service-test comparisons between appropriate groups. In addition, dose-response curves were evaluated using a sigmoidal dose-response analysis function in Prism 4.0 software (GraphPad, San Diego, CA, U.s.), which employs a 4-parameter logistic equation, co-ordinate to the Colina model: Y = min + (E max − min)/(ane + ten(dose−logEC50)), where min represents the initial resting muscle tension. In cases in which simply two experimental groups were being compared, a 2-tailed Pupil's t test was employed. Data are presented equally means ± se; P < 0.05 in all cases was considered significant.

Image processing

All RT-PCR and immunoblot gel images have been modified in contrast, brightness, and grayscale level in social club to heighten prototype quality. In all cases, adjustments were applied identically to a unmarried prototype. Some images have had the society of individual lanes digitally changed to maintain the same order of samples between all images.

RESULTS

Man airway smooth musculus contains mRNA encoding subunits of the glycine chloride channel

Messsenger RNA isolated by light amplification by stimulated emission of radiation microdissection from native airway smooth musculus independent within homo trachea (n=3–4), and mainstem bronchi was opposite transcribed into cDNA and amplified past PCR using primers (Table one) specific for each of the known 4 GLRA subunits and unmarried GLRB subunit of the GlyR Cl− aqueduct. PCR yielded products of predicted sizes for the GLRA1, GLRA2, GLRA4, and GLRB subunits of the GlyR Cl− channel, just non for the GLRA3 subunit ( Fig. 1 , lane b). RNA isolated from a homogenous cell population from an immortalized man airway smoothen muscle cell line (n=x) independent mRNA encoding all 4 known GLRA subunits and the GLRB subunit of the GlyR Cl− aqueduct (Fig. one, lane c). RNA from whole man brain (positive control) yielded PCR products of predicted sizes for all iv GLRA subunits and the GLRB subunit (Fig. i, lane d). Confirmation of sequence was performed on GLRA1, GLRA2, GLRA4, and GLRB (Supplemental Table S1).

An external file that holds a picture, illustration, etc.  Object name is z380051182360001.jpg

mRNA expression of GlyR Cl− channel subunits in man airway smooth muscle detected by RT-PCR. Representative gel images of RT-PCR products of known glycine subunits. RNA isolated from native human airway smooth muscle by light amplification by stimulated emission of radiation capture microdissection includes mRNA that encodes GLRA1, GLRA2, GLRA4, and the GLRB subunit of GlyR Cl− channels. RNA isolated from cultured human airway smooth muscle cells and whole man encephalon (positive control) express all four known GLRA subunits and the GLRB subunit of GlyR Cl− channels. Gel images are representative of the analysis of iii–10 individual samples from native and cultured homo airway smooth muscle. Lane a: negative control (no cDNA input); lane b: native human being airway smooth muscle; lane c: immortalized homo airway smooth musculus cells; and lane d: whole human brain.

GlyR Cl− channel subunit mRNA expression is conserved between humans and guinea pigs

RNA isolated from native guinea pig tracheal airway smoothen musculus using laser capture microdissection (n=2–four) also yielded RT-PCR products representing GLRA1, GLRA2, GLRA4, and GLRB subunits ( Fig. ii , lane b), simply GLRA3 was not expressed, in agreement with results seen in native human airway polish muscle. RNA isolated from whole guinea hog brain served every bit a species-specific positive control and yielded RT-PCR products of predicted sizes for all iv GLRA and the GLRB subunits of the GlyR Cl− aqueduct (Fig. 2, lane c). The conservation of subunit expression between guinea pigs and humans validated the use of republic of guinea grunter airway shine musculus for subsequent glycinergic functional studies. Confirmation of sequence of PCR was performed on GLRA1, GLRA2, GLRA4, and GLRB (Supplemental Table S1).

An external file that holds a picture, illustration, etc.  Object name is z380051182360002.jpg

mRNA expression of GlyR Cl−-channel subunits in guinea pig airway shine muscle detected by RT-PCR. Representative gel images of RT-PCR products of known glycine subunits. RNA isolated from native guinea pig airway smooth muscle past laser capture microdissection includes mRNA that encodes GLRA1, GLRA2, GLRA4, and the GLRB subunit of GlyR Cl− channels. RNA isolated from whole guinea pig brain (species-specific positive command) limited all 4 known GLRA subunits and the β subunit of GlyR Cl− channels. Gel images are representative of the analysis of two–4 individual samples from native guinea pig airway smooth musculus. Lane a: negative control (no cDNA input); lane b: native guinea pig airway smoothen musculus; and lane c: whole guinea hog brain.

Protein expression of GlyR Cl− channel subunits in human and guinea pig airway smooth muscle

Immunoreactive bands of expected molecular mass were detected by immunoblotting for the GLRA1 and GLRB subunits in native man ( Fig. iii , lane b) and guinea pig airway shine muscle (Fig. 3, lane d), as well as in cultured human airway polish muscle cells (north=4; Fig. three, lane c).

An external file that holds a picture, illustration, etc.  Object name is z380051182360003.jpg

Poly peptide expression of GlyR Cl− channel subunits in human and republic of guinea pig airway polish musculus detected by immunoblot. Representative gel images of immunoblot of known glycine subunits. Protein was extracted from native human being airway polish muscle, native guinea sus scrofa airway smooth musculus, and cultured immortalized human airway shine musculus cells and probed with antibodies against GLRA1 and the GLRB subunits of GlyR Cl− channels. Poly peptide isolated from homo whole brain and retinal lysates was used as positive controls. Gel images are representative of the analysis of 4 individual samples from native guinea pig airway smooth muscle, native man airway polish muscle, and immortalized human airway smooth muscle cells. Lane A: left panel, guinea pig retina; right panel, guinea squealer encephalon; lane B: native human airway smooth muscle; lane C: cultured immortalized human airway smooth muscle cells; and lane D: native guinea pig airway smooth musculus.

Glycine-induced current measurements in immortalized man airway smooth muscle cells

Glycine-gated chloride channel currents were measured using whole-prison cell inside-out patch-clamp configuration with equimolar cesium chloride both in the internal and external solutions. Three of seven cells displayed functional increases in current (∼20–30 pA) with treatments of glycine, when voltages were clamped at −lx mV. A representative tracing of a typical glycine induced electric current is shown ( Fig. iv B ). To show the relative magnitude of the chloride current of the GlyR Cl− channel, buffer (Fig. iv A) and 40 mM potassium gluconate (Fig. 4 C) control current measurements were performed, and currents were measured. Treatment with 40 mM potassium gluconate resulted in a current measurement ranging from ∼120 to 250 pA in 5 of 5 cells.

An external file that holds a picture, illustration, etc.  Object name is z380051182360004.jpg

Electrophysiological demonstration of GlyR Cl−-channel current activity in airway smooth muscle cells. Representative tracings of a airway polish musculus in whole-cell configuration under voltage. A) Buffer addition. B) Glycine (ane mM) yielded a 24-pA current. Similar tracings were recorded in 3 of 7 cells patched. C) Grand-gluconate (40 mM) yielded a 212-pA electric current. Similar tracings were recorded in 5 of 5 cells patched.

Quantification of glycine-induced plasma membrane potential changes in cultured airway smoothen muscle cells in relation to FLIPR emission fluorescence

A standard curve was derived using dose responses to potassium gluconate in the FLIPR microplate reader experiments and in electrophysiological recordings of membrane potential. A Boltzmann nonlinear regression curve fit was used to generate dose-response curves ( Fig. 5 A ). A linear plot was then derived from the relationship of these ii curves creating a fluorescence [relative fluorescence units (RFU)] vs. membrane potential (mV) relationship plot (Fig. five B).

An external file that holds a picture, illustration, etc.  Object name is z380051182360005.jpg

Quantification of glycine-induced plasma membrane potential (mV) changes in cultured airway shine muscle cells in relation to FLIPR emission fluorescence. A) Dose response to K gluconate, measuring either fluorescence [relative flurorescence units (RFU); lesser curve, right axis] or membrane potential (elevation bend, left axis) in cultured airway smoothen musculus cells. Fluorescence was measured by potentiometric FLIPR dye, and membrane potential was measured by electrophysiological whole-prison cell recordings. Curves were approximated using a Boltzmann nonlinear regression curve fit. B) Linear regression of matched data points from panel A Boltzmann curves, correlating membrane potential change to fluorescence change.

During the FLIPR fluorescent dye studies, 1 mM glycine treatments were performed with hyperpolarization controls (100 μM NS1619) and depolarization controls (40 mM G gluconate) ( Fig. vi B ). Cells treated with 1 mM glycine displayed a hateful ± se value of 71 ± 25 RFU (Fig. vi A). According to the linear plot of fluorescence vs. membrane potential, 71 RFU correlates to a change in membrane potential of ten–xv mV.

An external file that holds a picture, illustration, etc.  Object name is z380051182360006.jpg

FLIPR dye assessment of depolarization and hyperpolarization stimulation of airway polish muscle in response to NS1619, Grand-gluconate and glycine. A) Graphical representation of FLIPR potentiometric dye fluorescence emissions (RFU) after cultured airway smooth muscle cells were treated with either buffer (command), 1 mM glycine, 40 mM Grand-gluconate, or 100 μM NS1619 (north=vi–12). Mean mean ± se fluorescence change for one mM glycine is 71 ± 25 RFU; for Grand-gluconate, 142 ± 22 RFU. B) Representative tracing of real-time FLIPR potentiometric dye fluorescence emissions later cultured airway smooth muscle cells were treated with either buffer, 1 mM glycine, 40 mM K-gluconate, or 100 μM NS1619. Tracings display directionality of fluorescence alter in relation to depolarization (upward deflection: glycine Grand-gluconate) and hyperpolarization (down deflection: NS1619).

Glycine induces plasma membrane potential changes in cultured airway smooth muscle cells, which is adulterate by a GlyR Cl− channel-specific antagonist

Glycine dose-response curves were performed using a membrane potentiometric fluorescent dye, which yielded an EC50 value for glycine of 106 μM (north=4; Fig. 7 ), which is a value like to the EC50 values measured in HEK cell lines overexpressing GlyR Cl− channel subunits (ix). Glycine dose-response curves were generated afterwards pretreatment with 400 μM strychnine, which shifted the glycine ECfifty over 2 log orders of magnitude (n=3–half-dozen). These studies show that glycine dose dependently induced ion move in human airway smooth muscle cells that was finer blocked by the specific GlyR Cl− channel antagonist strychnine.

An external file that holds a picture, illustration, etc.  Object name is z380051182360007.jpg

Dose-dependent glycine effects on membrane potential in cultured human airway polish musculus cells. Glycine dose-dependently (1 μM to 1 M) increases fluorescent intensity, indicative of a change in membrane potential in cultured human airway polish muscle cells, yielding an EC50 value of 106 μM for glycine (n=4). This glycine dose-response curve was shifted to the right, increasing the EC50 by ii log orders of magnitude in the presence of 400 μM strychnine.

Glycine directly relaxes acetylcholine-induced wrinkle in guinea squealer tracheal rings

To demonstrate that glycine tin straight relax airway polish muscle contracted by the classic contractile agonist acetylcholine, maintenance of muscle strength was measured in guinea pig tracheal rings contracted with acetylcholine. Republic of guinea grunter tracheal rings contracted with EC50 dose of acetylcholine had a decrease in the maintenance of musculus force over a 600-due south period when 1 mM glycine was added at the height of the induced contraction, compared to control rings, which actually demonstrated an increase in muscle force over the same period (northward=three; P<0.01; Fig. 8 ).

An external file that holds a picture, illustration, etc.  Object name is z380051182360008.jpg

Glycine treatment of guinea pig tracheal band airway smoothen musculus inhibits maintenance of muscle forcefulness induced past acetylcholine EC50. Republic of guinea squealer tracheal rings contracted by EC50 concentration of acetylcholine demonstrated a reduced maintenance of contracted tone over 600 south in the presence of ane mM glycine. *P < 0.01 (n=3).

Glycine direct relaxes neurokinin A-induced contraction in guinea pig tracheal rings

To demonstrate that glycine can directly relax airway smooth muscle (in addition to potentiating isoproterenol-induced relaxation) and to demonstrate that prorelaxant furnishings of glycine were not limited to ane contractile agonist, maintenance of muscle force was measured in guinea pig tracheal rings contracted with neurokinin A. Republic of guinea pig tracheal rings contracted with 100 nM neurokinin A had a decrease in the maintenance of musculus force over a 1200-southward period when ane mM glycine was added at the peak of the induced contraction, as opposed to command rings, which demonstrated an increase in muscle force over the same period (north=eight–9; P<0.05; Fig. 9 ).

An external file that holds a picture, illustration, etc.  Object name is z380051182360009.jpg

Glycine treatment of guinea hog tracheal ring airway smooth muscle inhibits maintenance of muscle forcefulness induced by neurokinin A. Republic of guinea hog tracheal rings contracted by 100 nM neurokinin demonstrated a reduced maintenance of contracted tone over 1200 south in the presence of ane mM glycine. *P < 0.05 (n=8–9).

Glycine and a glycine channel agonist each potentiate isoproterenol induced relaxation of acetylcholine-contracted guinea squealer airway shine muscle

Guinea pig airway polish muscle rings under isometric tension in organ baths were contracted with an EC50 concentration of acetylcholine and relaxed with cumulatively increasing concentrations of isoproterenol in the absence or presence of glycine (with or without the GlyR Cl− aqueduct adversary, strychnine) or taurine, a ligand with partial analogousness for the GlyR Cl− channel (with or without the antagonsist strychnine). The ECfifty for relaxation induced by isoproterenol alone was 9.ii nM (northward=13; Fig. 10 A ). In the presence of the partial agonist taurine (200 μM), the isoproterenol-induced relaxation shifted to the left, yielding an ECl value of three.iv nM (n=xiii; Fig. 10 A). To specifically implicate the activation GlyR Cl− channels past taurine, 2 GlyR Cl− channel-specific antagonists were included in organ bathroom buffers of the tracheal rings; strychnine and ginkoglide B (3 and 1 μM, respectively). The dose response for isoproterenol-induced relaxation in the presence of taurine and the GlyR Cl− channel antagonists was shifted back to the right, yielding an ECl value (7.8 nM) similar to that obtained with isoproterenol alone (n=14; Fig. 10 A). Extrapolated data from the dose-response curves well-nigh the isoproterenol EC50 value (v nM; Fig. x B), shows that at a dose of 5 nM isoproterenol, taurine increases relaxation significantly (P<0.01) compared to command (n=thirteen–14; Fig. 10 B). Handling with the antagonists strychnine and ginkgolide B blocks taurine-induced enhanced relaxation (P>0.05) compared to command (north=13–14; Fig. 10 B).

An external file that holds a picture, illustration, etc.  Object name is z380051182360010.jpg

Isoproterenol-induced relaxation of acetylcholine-contracted republic of guinea pig airway smooth musculus is enhanced by the partial GlyR Cl− channel agonist taurine. A) Isoproterenol concentration-response curves comparison treatment with isoproterenol only (▵) to isoproterenol after a unmarried concentration of 100 μM taurine (■) or isoproterenol with a single concentration of 100 μM taurine in the presence of 3 μM strychnine and ane μM ginkgolide B (○). Taurine (100 μM) enhancement of isoproterenol relaxation was reversed in the presence of GlyR Cl− channel-specific inhibitors ginkgolide B and strychnine (due north=13–fourteen). B) Relaxation of acetylcholine-induced contraction past a single dose of isoproterenol (iso; 5 nM) is enhanced past taurine (taur; 100 μM). This taurine enhancement of isoproterenol-mediated relaxation was reversed in the presence of strychnine (strych; 3 μM) and ginkgolide B (1 μM). *P < 0.01 vs. control (due north=xiii–14); # P = ns vs. control (n=13–14).

In another group of studies, isoproterenol alone showed a relaxation curve yielding an ECfifty value of 11.1 nM (due north=11; Fig. 11 A ). Glycine (ane mM) shifted the relaxation curve to the left, yielding an EC50 value of four.five nM (n=16; Fig. xi A). To confirm that glycine's effects were on the GlyR Cl− channels, strychnine (30 μM) was included in the organ bath buffer, and isoproterenol-induced relaxation curves in the presence of glycine with strychnine were shifted to the right, yielding an EC50 value (8.8 nM) similar to that obtained with isoproterenol alone (n=7; Fig. 11 A). Extrapolated data from the dose-response curves near the isoproterenol EC50 value (10 nM; Fig. 11 A), shows that at a dose of 10 nM isoproterenol, glycine increases relaxation significantly (P<0.01) compared to control (n=11–sixteen; Fig. 11 B), while treatments with strychnine counteract glycine-induced enhanced relaxation, yielding isoproterenol EC50 values not significantly different from controls (n=vii–11; P>0.05; Fig. 11 B).

An external file that holds a picture, illustration, etc.  Object name is z380051182360011.jpg

Isoproterenol-induced relaxation of acetylcholine-contracted republic of guinea pig airway smooth muscle is enhanced past glycine. A) Isoproterenol concentration-response curves comparing treatment with isoproterenol simply (■) to isoproterenol after a single concentration of i mM glycine (▵) or isoproterenol with a single concentration of 1 mM glycine in the presence of 30 μM strychnine (○). This glycine enhancement of isoproterenol relaxation was reversed in the presence of the GlyR Cl− channel-specific inhibitor, strychnine. (due north=7–16). B) Relaxation of acetylcholine-induced wrinkle by a single dose of isoproterenol (iso; x nM) is enhanced past glycine (one mM). This glycine enhancement of isoproterenol-mediated relaxation was reversed in the presence of strychnine (strych; 30 μM). *P < 0.05 vs. command (n=11–xvi); # P = ns vs. command (north=7–11).

Discussion

The primary findings of the present report are that GlyR Cl− channels are expressed on airway shine muscle cells, and they function to facilitate relaxation of airway shine muscle. This novel finding points toward new therapeutic targets for relaxation of constricted airway smooth muscle in diseases such as asthma and chronic obstructive pulmonary disease.

Our laboratory recently discovered the functional expression of the GABAA ligand-gated chloride channels in airway polish musculus (four). In studies characterizing the GABAA channel, information technology was noted that taurine, an agonist at both GABAA and GlyR Cl− channels, potentiated relaxation, but this effect was only partially reversed past the GABAA aqueduct antagonist gabazine. This led usa to question whether part of the effect of taurine was due to activity at a previously undescribed GlyR Cl− aqueduct in airway polish musculus. Indeed, in the present study, we show that taurine-induced potentiation of isoproterenol-mediated relaxation of airway smooth muscle is reversed past strychnine and ginkgolide B, GlyR Cl− aqueduct antagonists. Moreover, nosotros also demonstrate that the endogenous ligand glycine too potentiated isoproterenol-mediated relaxation and was also blocked by GlyR Cl− channel antagonism. Furthermore, glycine alone was able to attenuate the maintenance of a contraction initiated by some other contractile agonist, β-ala NKA fragment four–ten, in airway smooth musculus.

These functional studies led united states to ostend the molecular expression of GlyR Cl− channel subunits in airway smooth muscle. GlyR Cl− channels, like their superfamily relatives, the GABAA channels, are widely expressed in neuronal cells, merely their extraneuronal expression and function have been less widely studied. GlyR Cl− channels take been establish in human macrophages, endothelial cells, and certain endocrine glands (five, 12, 13). The present study demonstrates mRNA and protein expression of multiple subunits of GlyR Cl− channels in airway smoothen muscle. Messenger RNA encoding the GLRA1, GLRA2, GLRA4, and GLRB subunits were identified in native airway smooth muscle from trachea of humans and guinea pigs. The glycine GLRA3 subunit mRNA is not nowadays in native guinea grunter or human airway shine muscle, but it was detected in immortalized human being airway smooth musculus cells. Evidence of modulation in glycine subunit expression has previously been demonstrated in cells in civilisation (14). We hypothesize that civilization atmospheric condition, serum, or growth factor components may induce glycine GLRA3 subunit expression in cultured human airway smooth musculus cells. Our studies identified mRNA encoding the GLRA4 subunit in guinea pigs as 2 splice variants (data not shown for one variant) and a single variant in human airway smooth muscle. Although GLRA4 subunit mRNA expression was establish in the present study in homo airway polish musculus, previous studies have shown that exon 9 of the GLRA4 subunit has a cease codon in humans, preventing the translation of the fourth transmembrane domain of the GLRA4 subunit protein, which would render information technology nonfunctioning (15).

Assay of poly peptide expression focused on the GLRA1 and β subunits for 2 reasons. Our written report of membrane potential with a potentiometric dye showed the EC50 of glycine to be 106 μM. This is like to the EC50 of glycine for GlyR Cl− channels composed of GLRA1/GLRB subunits (89 μM; ref. nine) or homomeric GLRA1 subunits (82 μM; ref. nine). In contrast, the glycine ECfifty for GLRA2 homomeric GlyR Cl− channels is 290 μM (9). Second, the GLRA1/ GLRB subunit combination is the predominantly expressed combination in adult human neurons, while expression of glycine GLRA2 subunits is predominantly limited to neonatal neurons (six). We did not detect glycine GLRA3 mRNA in native airway smooth muscle, and full-length functional glycine GLRA4 subunits have not been described in man tissues. We identified protein expression of glycine GLRA1 and GLRB subunits in native human and guinea squealer airway smoothen musculus, as well as cultured human airway polish muscle cells. The finding of these subunits in a homogeneous population of cultured airway smooth muscle cells further confirms expression of GlyR Cl−-channel subunit proteins directly on airway smooth muscle cells. This conservation of expression between species helps validate the employ of guinea sus scrofa airway smooth musculus cells in our accompanying functional studies.

GlyR Cl− channels human action as ligand-gated pores, which are selective for anion motion (5). Whatever anion movement in or out of the cell volition lead to a change in the membrane potential. Chloride movement is dictated by membrane potential in relation to the chloride equilibrium potential. Therefore, opening of a chloride channel at resting membrane potential, which is beneath the chloride equilibrium potential in ASM, would allow for chloride efflux, causing depolarization. Nevertheless, at a depolarized land, post-obit a contractile agonist, the membrane potential is to a higher place the chloride equilibrium, resulting in inward chloride flow and relative hyperpolarization.

Using potentiometric dyes, nosotros demonstrate in the present study that glycine dose dependently changes membrane potential in man airway shine muscle cells, and this effect was significantly blocked, but not fully blocked, past pretreatment with the GlyR Cl− channel adversary strychnine. Glycine as a ligand is known to human action on other channels and have effects on ion motion. For example, NMDA channels use glycine as a coagonist with glutamate and open nonspecific cation channels on airway smooth muscle (16). In add-on, cotransport of glycine with sodium and chloride through glycine transporters (GLYT) may be some other pathway in which glycine changes the electrophysiological properties of ASM (17); withal, GLYT has not yet been demonstrated on ASM. Although we were not able to reach full occludent of glycine treatment effects using strychnine in the potentiometric dye studies, we were able to fully opposite the effects of glycine with strychnine (GlyR Cl− aqueduct-specific antagonist) in the airway relaxant studies. These results suggest that glycine may have furnishings on channels and cotransporters other than GlyR Cl− channels, but the relaxation caused past glycine treatments is mainly due to glycine receptor chloride channels.

To determine whether glycine could direct contribute to the relaxation of airway smooth musculus (independently of isoproterenol), the maintenance of muscle force with or without glycine was measured following agonist (acetylcholine or β-ala NKA fragment iv–10) induced contractions. Glycine significantly adulterate the maintenance of these contractions.

Clinical relaxation of constricted airway smooth muscle in diseases, such as asthma and chronic obstructive pulmonary affliction, is classically achieved with β-adrenoreceptor agonists. Therefore, our initial functional studies of glycine in isolated republic of guinea pig tracheal rings employed wrinkle with a chief endogenous airway constrictor (acetylcholine) followed by relaxation with the β-adrenoreceptor ligand (isoproterenol). I mechanism by which β-agonists relax airway smooth muscle is past opening calcium-activated potassium (KCa) channels (7), assuasive for the efflux of potassium to hyperpolarize plasma membrane potential, thus reversing the membrane depolarization induced during wrinkle. We hypothesized that opening of the glycine ligand-gated chloride channel nether depolarized (acetylcholine-contracted) conditions should favor chloride influx and contribute to the relative hyperpolarization afforded by β-agonists, further facilitating relaxation. Indeed, our functional studies demonstrate that both glycine and taurine shift the isoproterenol dose-response curve toward enhanced relaxation, and these furnishings were blocked by the GlyR Cl− channel adversary strychnine. These results hold with our previous studies using another ligand-gated chloride channel, the GABAA channel (10).

The relative importance of plasma membrane potential in the initiation and maintenance of contraction of an airway polish musculus cell has been controversial (7, eighteen). Early studies of the importance of membrane potential in this jail cell type focused on the role of L-blazon calcium channels, because this was ane of the earliest described voltage-dependent channels in this cell type. Enthusiasm for an important office for the L-type calcium channel (and membrane potential) was macerated when clinical trials of Fifty-blazon calcium channel antagonists yielded only modest benefits in asthmatics (19) and when it was realized that full opening of the L-type calcium channel requires a membrane potential, threshold to peak, of about −35 to 10 mV, values not believed to be naturally achieved in a depolarized airway smooth muscle cell (3). Still, bear witness remains for a part of membrane potential in airway smooth muscle contraction and relaxation, including the opening of KCa channels as a component of β-agonist relaxation; the ability to induce airway polish musculus contraction with blockade of potassium channels (due east.one thousand., tetraethylammonium chloride, iberiotoxin); and the identification of T-type calcium channels in airway smooth muscle, which fully open at a more than hyperpolarized membrane potential compared to the earlier characterized 50-blazon calcium channel (three).

Traditional understanding of airway smooth musculus contraction has focused on a central 2nd messenger pathway activated by classic contractile agonists: the Gq protein pathway activating protein kinase C and phospholipase C (PLC), resulting in the synthesis of inositol phosphate (IP3) and the liberation of calcium from sarcoplasmic reticulum (SR) stores. A growing amount of prove suggests that this Gq-PLC-IPiii-Ca signaling pathway does not function independently of membrane potential (20, 21). In addition, changes in membrane potential have been shown to activate both M3 muscarinic receptors (Gq coupled; ref. two) in airway smooth musculus cells and M2 muscarinic receptors (Gi coupled; ref. 22) independent of receptor occupancy by ligand.

Moreover, evidence that SR-released calcium can actuate plasma membrane chloride channels, inducing depolarization (23), suggests that 2d messenger regulation of intracellular SR calcium release and plasma membrane potential practice not operate in isolation. Furthermore, membrane potential regulation of Rho kinase activity has been described. Rho kinase-mediated deactivation of myosin low-cal-chain phosphatase increases contractile sensitivity to cytoplasmic calcium influx whether the calcium arises from extracellular or intracellular sources. Depolarization induced by electric field stimulation (24) or pharmacologically (i.e., potassium chloride; ref. 25) take both demonstrated increases in Rho kinase action and increases in musculus force generation. Thus, depolarization of the cytoplasmic membrane not only has a traditional role in plasma membrane calcium channel activation but too regulates key Grand-protein-coupled intracellular calcium pathways and phosphorylation of contractile proteins sensitive to calcium, resulting in enhanced muscle force generation.

This novel identification of GlyR Cl− channels in airway smooth musculus tin can be added to a growing listing of chloride channels found on the airway smooth muscle, including the cystic fibrosis transmembrane receptor (CFTR; ref. 26), recently identified calcium-activated chloride channels of the anoctamin or TMEM16 family (27), GABAA channels (4) and at present GlyR Cl− channels. The numerous and specific ways in which the airway smooth musculus prison cell can regulate chloride motion may underscore the previously unrecognized importance of these anions in airway polish musculus cellular processes. Further studies on the role of chloride and membrane potential modulation may uncover physiological and pathophysiological mechanisms in airway smooth muscle and ultimately may elucidate new pharmacologic targets.

In summary, we demonstrate for the start time the expression of GlyR Cl− channels on human and guinea pig airway smooth muscle that function to alter membrane potential and contribute to relaxation of airway smooth muscle from contractions induced by acetylcholine, a muscarinic receptor agonist, or β-ala NKA fragment 4–10, a tachykinin receptor agonist. These ligand-gated chloride channels may be a novel therapeutic target for the regulation of airway smooth muscle tone in diseases such as asthma and chronic obstructive pulmonary illness.

Supplementary Cloth

Footnotes

REFERENCES

1. Wijesinghe M., Weatherall M., Perrin K., Harwood M., Beasley R. (2009) Run a risk of bloodshed associated with formoterol: a systematic review and meta-analysis. Eur. Respir. J. 34, 803–811 [PubMed] [Google Scholar]

2. Liu Q. H., Zheng Y. Chiliad., Korde A. S., Yadav V. R., Rathore R., Wess J., Wang Y. Ten. (2009) Membrane depolarization causes a direct activation of G poly peptide-coupled receptors leading to local Catwo+ release in smoothen musculus. Proc. Natl. Acad. Sci. U. S. A. 106, 11418–11423 [PMC free commodity] [PubMed] [Google Scholar]

3. Janssen L. J. (1997) T-type and L-type Ca2+ currents in canine bronchial shine musculus: label and physiological roles. Am. J. Physiol. Cell Physiol. 272, C1757–C1765 [PubMed] [Google Scholar]

4. Mizuta Chiliad., Xu D., Pan Y., Comas G., Sonett J. R., Zhang Y., Panettieri R. A., Jr., Yang J., Emala C. Westward., Sr. (2008) GABAA receptors are expressed and facilitate relaxation in airway smooth muscle. Am. J. Physiol. Lung Cell. Mol. Physiol. 294, L1206–L1216 [PMC costless article] [PubMed] [Google Scholar]

five. Lynch J. West. (2004) Molecular construction and function of the glycine receptor chloride channel. Physiol. Rev. 84, 1051–1095 [PubMed] [Google Scholar]

six. Lynch J. Due west. (2009) Native glycine receptor subtypes and their physiological roles. Neuropharmacology 56, 303–309 [PubMed] [Google Scholar]

7. Kotlikoff M. I., Kamm K. E. (1996) Molecular mechanisms of beta-adrenergic relaxation of airway smoothen muscle. Annu. Rev. Physiol. 58, 115–141 [PubMed] [Google Scholar]

8. Gosens R., Stelmack One thousand. L., Dueck G., McNeill Thou. D., Yamasaki A., Gerthoffer W. T., Unruh H., Gounni A. S., Zaagsma J., Halayko A. J. (2006) Function of caveolin-i in p42/p44 MAP kinase activation and proliferation of human being airway smooth musculus. Am. J. Physiol. Lung Jail cell. Mol. Physiol. 291, L523–L534 [PubMed] [Google Scholar]

9. Jensen A. A. (2005) Functional characterisation of human glycine receptors in a fluorescence-based loftier throughput screening assay. Eur. J. Pharmacol. 521, 39–42 [PubMed] [Google Scholar]

10. Gallos G., Gleason North. R., Zhang Y., Pak South. Westward., Sonett J. R., Yang J., Emala C. W. (2008) Activation of endogenous GABAA channels on airway smooth musculus potentiates isoproterenol-mediated relaxation. Am. J. Physiol. Lung Prison cell. Mol. Physiol. 295, L1040–L1047 [PMC free commodity] [PubMed] [Google Scholar]

eleven. Jooste E., Zhang Y., Emala C. W. (2005) Rapacuronium preferentially antagonizes the function of M2 versus M3 muscarinic receptors in guinea pig airway polish muscle. Anesthesiology 102, 117–124 [PubMed] [Google Scholar]

12. Froh M., Thurman R. 1000., Wheeler Yard. D. (2002) Molecular evidence for a glycine-gated chloride aqueduct in macrophages and leukocytes. Am. J. Physiol. Gastrointest. Liver Physiol. 283, G856–G863 [PubMed] [Google Scholar]

xiii. den Eynden J. 5., Ali S. S., Horwood Northward., Carmans South., Brone B., Hellings N., Steels P., Harvey R. J., Rigo J. Grand. (2009) Glycine and glycine receptor signalling in non-neuronal cells. Front. Mol. Neurosci. two, 9. [PMC free article] [PubMed] [Google Scholar]

14. Elster Fifty., Banke T., Kristiansen U., Schousboe A., Wahl P. (1998) Functional properties of glycine receptors expressed in main cultures of mouse cerebellar granule cells. Neuroscience 84, 519–528 [PubMed] [Google Scholar]

15. Simon J., Wakimoto H., Fujita N., Lalande G., Barnard E. A. (2004) Assay of the prepare of GABA(A) receptor genes in the man genome. J. Biol. Chem. 279, 41422–41435 [PubMed] [Google Scholar]

16. Nassar T., Yarovoi S., Fanne R. A., Akkawi S., Jammal K., Allen T. C., Idell South., Cines D. B., Higazi A. A. (2010) Regulation of airway contractility by plasminogen activators through Northward-methyl-d-aspartate receptor-1. Am. J. Respir. Cell Mol. Biol. 43, 703–711 [PMC free article] [PubMed] [Google Scholar]

17. Roux One thousand. J., Supplisson Due south. (2000) Neuronal and glial glycine transporters have dissimilar stoichiometries. Neuron 25, 373–383 [PubMed] [Google Scholar]

18. Janssen Fifty. J. (2002) Ionic mechanisms and Ca2+ regulation in airway smooth muscle contraction: do the data contradict dogma? Am. J. Physiol. Lung Cell. Mol. Physiol. 282, L1161–L1178 [PubMed] [Google Scholar]

19. Ahmed T., D'Brot J., Abraham West. (1988) The role of calcium antagonists in bronchial reactivity. J. Allergy Clin. Immunol. 81, 133–144 [PubMed] [Google Scholar]

20. Mahaut-Smith M. P., Martinez-Pinna J., Gurung I. S. (2008) A function for membrane potential in regulating GPCRs? Trends Pharmacol. Sci. 29, 421–429 [PubMed] [Google Scholar]

21. Imtiaz M. South., von der Weid P. Y., van Helden D. F. (2010) Synchronization of Ca2+ oscillations: a coupled oscillator-based mechanism in smoothen muscle. FEBS J. 277, 278–285 [PubMed] [Google Scholar]

22. Ben-Chaim Y., Tour O., Dascal N., Parnas I., Parnas H. (2003) The M2 muscarinic G-protein-coupled receptor is voltage-sensitive. J. Biol. Chem. 278, 22482–22491 [PubMed] [Google Scholar]

23. Wang Y. X., Kotlikoff Grand. I. (1997) Muscarinic signaling pathway for calcium release and calcium-activated chloride current in smooth muscle. Am. J. Physiol. 273, C509–C519 [PubMed] [Google Scholar]

24. Sahan-Firat S., Tiftik R. Northward., Nacak M., Buyukafsar K. (2005) Rho kinase expression and its key role in ovine gallbladder contractions elicited past a variety of excitatory stimuli. Eur. J. Pharmacol. 528, 169–175 [PubMed] [Google Scholar]

25. Janssen L. J., Tazzeo T., Zuo J., Pertens E., Keshavjee Southward. (2004) KCl evokes wrinkle of airway smooth muscle via activation of RhoA and Rho-kinase. Am. J. Physiol. Lung Cell. Mol. Physiol. 287, L852–L858 [PubMed] [Google Scholar]

26. Michoud Grand. C., Robert R., Hassan Yard., Moynihan B., Haston C., Govindaraju V., Ferraro P., Hanrahan J. W., Martin J. G. (2009) Role of the cystic fibrosis transmembrane conductance aqueduct in human airway smooth muscle. Am. J. Respir. Jail cell Mol. Biol. 40, 217–222 [PubMed] [Google Scholar]

27. Huang F., Rock J. R., Harfe B. D., Cheng T., Huang X., Jan Y. N., January L. Y. (2009) Studies on expression and function of the TMEM16A calcium-activated chloride channel. Proc. Natl. Acad. Sci. U. S. A. 106, 21413–21418 [PMC complimentary article] [PubMed] [Google Scholar]


Manufactures from The FASEB Periodical are provided here courtesy of The Federation of American Societies for Experimental Biology


graylikerseld.blogspot.com

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4048936/

Post a Comment for "what cells have glycine receptors to inhibit muscle contraction"